Accurate as of March 1, 1995

Table 1. Compilation of Bacillus subtilis sA-dependent promoter elements. GENE SEQUENCE SL SS REF -100 -90 -80 -70 -60 -50 -40 -30 -20 -10 +1 +15 --- o

(A) PROMOTERS WITH BIOCHEMICAL OR GENETIC SUPPORTING DATA

abr TTCGGTAGTTTCCAAGACATTACTGACTATAAGAACTAATTCTTACAATCAATAGTAAACAAAATGATTGACGATTATT---GGAAACCTTGTTATGCTATGAAGgTAAGGATTTTGTCGAAT 17 PE (1) acka AACCTATAGTGAATGTGTCTGAAAATAACGACTTCTTATTGTAAGCGTTATCAATACGCAAGTTGACTTGAAAAGCCGA---CATGACAATGTTTAAATGGAAAAgTCAGATATTTTTCGGAG 17 PE (2) acsA AAAATACATGCCTTCTTTAAGAATACCAAATTATAAAGCGTTTTCAACATGGTTTATATTTTAAAAATTGAGAAGAATA---TGAATATATACTATAATAATTGTgACAACTTCAGCAAAGGG 17 PE (3) acuA GCTGAAGTTGTCACAATTATTATAGTATATATTCATATTCTTCTCAATTTTTAAAATATAAACCATGTTGAAAACGCTT----TATAATTTGGTATTCTTAAAGAaGGCATGTATTTTTGATA 16 PE (3) ada TTGAAATTAGTTTATCACATAATCATCTTTACTCATTTTGTTATCTTGCTATTACATTCTAACCACCTTATTTTTTTCT---ATTTATGAGGTTATAGTGTAGTTaTCAAGAATGCTAAACGG 17 PE (4) addA GGGAGAGATGTGCGGAGATAATCAGCTTTTTATATGTGAAAAGGCCGTTTTTACCAATAGATCAGATTGGTCATTTTCG---TCAACATTCGATAAAATATAGaGAGATAAAAAGAGAGGGGT 17 PE (5) ald AAACCTTCCGGCACATGGATTTGTGAAATTTCACAAATCCATGTTTTTTTATTTTCTTAATCAAACAAAGAATTTTCCA---AAATATCAAGCTACACTAAAAATaTCACATATACAGGAGGA 17 PE (6) alkA TAACTACACTATAACCTCATAAATAGAAAAAAATAAGGTGGTTAGAATGTAATAGCAAGATAACAAAATGAGTAAAGAT----GATTATGTGATAAACTAATTTCaACCAGCGTGAGTTTTCT 16 PE (4) alsS TCAATATGCATTCCTTTCCATAGGTTAATAATTCGTATTACATATTAATCATAAGGTCGAATCGATATTGGAGGTCAAT--TTCCAAAGAGTGTATAGTGAAACTTaTCACAAGATATTTAAA 18 PE (7 amyLY AGGGAAGCGTTCACAGTTTCGGGCAGCTTTTTTTATAGGAACATTGATTTGTATTCACTCTGCCAAGTTGTTTTGATAG---AGTGATTGTGATAATTTTAAATGTaAGCGTTAACAAAATTC 17 S1 (8) ansA TTTTTCACCTTGAGCTGATTATATCATATAGGTATTAGGAAGTGTACGCGAATTGAATAATAATGTCTTGCGTATTTTA---TTTTCCGTGTCTATAATTGCATtAAAAGTATGCGAAAAGCG 17 PE (9) aprE GAGTCTCTACGGAAATAGCGAGAGATGATATACCTAAATAGAGATAAAATCATCTCAAAAAAATGGGTCTACTAAAATA-TTATTCCATCTATTACAATAAATTCaCAGAATAGTCTTTTAAG 19 PE (10) argC GCTGTCAAACATGAGAATTCCCATTGAACAGAAAATTTATAAATGAATAAAAATATTAAATATACGATTGAATTAATTT----TTATTCATGTTATAATGTTAAATaATTTCACAAAGACCAA 16 PE (11,12) asd TCTAGTTGAGAATTATCAGGGAAATGACTAAATTTACAGAAAATCTTTCCCAAACTAAAAAATTCGGTCATCACCCGCA----TATTCTATGGTAAAATAAAACGtAAAATCATAGTCAAATC 16 PE (13) cdd TTATTTTTTTGCCAAAGCTGTAATGGCTGAAAATTCTTACATTTATTTTACATTTTTAGAAATGGGCGTGAAAAAAAGC---GCGCGATTATGTAAAATATAAaGTGATAGCGGTACCATTAT 17 S1 (14,15) citA GAAGCCATTTGAAATCCATTTCTATTCTCCCTCTGATTAATATTTTTAATTAATTCCCTTTAAAATATTGATTATTTTT---TAAATATTATATTTACTATAATAaCAGAAAAGGATAGGGGG 17 PE (16) citB ACAGTAAAAATTACCGGTACATTTTTCTCATAAGTCGAACTTATTGTATTTAATAAAAACATTGATTTTACTATATGT--ATGATTTTGTTTTAATATGAAATTgTGAGAAAATTGTGATGG 18 RN (17,18) citC CCGATTGAAGAAAGAGCCTAAAGAACCATTGGAGGCTGGCTTGCGTCAATGAGGTTAGCCTCTTGTTCAGACATCAAAA---TTGGGTTACACTTTAAATTGAATgTTAGGAAAAATCATTTT 17 PE (16) citR TGGATGTTTCTACACATGTAATTCCCTTTAATCCGTAATGTACCATTTGTATTCCCCCTATCCTTTTCTGTTATTATAG---TAAATATAATATTTAAAAAATAaTCAATATTTTAAAGGGAA 17 PE (16) citZ AACCCGCAAATAAAGGCGTTTTTTCGGGGAAATCACAGAATGGAAAAAAAAAATTATAGGTAAACATTTAACAAATGTC---TGATTATTGTTTATAATGAGAATaGGCTTAAACTTAAATAA 17 PE (16) comA AAGTGAAGGAAAGGGCTTTAAGGCTGATATTGAAATCGAATTGTAATGGATTTATAACGGAAACGACTTGGCACAGGCC----AAGTCTTTTTTATAAAATGGAaaAGAGTGAGTAAAAGGGA 18 S1 (19) comB TAAAGAAAAACTGGCCTTTCATTCGCGAAGGGCCAGTTTTCTTTATGTATATATTATTTTTCATGTTTAGACAATTTTCGTCAAATTATTTGATATACTTAGGGGTgAAAGCCGCGCGTATTG 20 PE (19) comC TCCGGCTCCGGCAGAATCAAAAAAAGATTCTGCCGTTTTTTTCATGTGTAAAATTGAATATTCCCAATTGGAGCTCAGG-ATGTCCATTTTGCTACAATCCATACCAgAACTCAATGAGTAAA 19 PE (20,21) comE CAAGGCGCAGAAATCAAAAACCATCGTTTCCTAAAACGATGGTTTTTTAAAATGCTTTTTTATGCTTTTGCAGTACAGA---CGAACGTATGACATACTCGTCTaCACATGAAACTGCTTTTT 17 PE (22) comF GTGTTTTAAATAAGGCCAAATCTCCGTTTTTAGAGCGGAGATTTTTTTATATTCTTATTTTAATAGTTGGACAGAAAAT---ATTCATTCAGGCATACTGTTTCgAAAGGAGGCGTGCTATGT 17 PE (23) comG CTTTTTTCTTGCCAGAAAGAATTGGTTTTTCAGCATATAACATCTCACAAAATCACGTTTTCCCTGTTTGATTACCTTT---TCTTCTTTTTCTACAATATGCGTTgAAAGGAGAGGGAATCA 17 PE (24) comK TATTACTAGTCATTTAGTACCATTAAATATCATTAAAAGATGATTTTATCTTAAATGTTAAAAAAACCTGTCGTTTTAC--AAAAACAGATGATAGATTATTAgTATAAATTTTGCAGAAAAA 18 PE (25) comQ TTTTTTCGTTCTACCGATACAATAAATGGATAAAGTATTATATGATTGTTAAAAAACGAAAAACCTGCTGTCCTTTAAA--TGTCCCATTTAGTAAAATGGAATgGGAGGGGGGAAGTCGTT 18 PE (26) cspB TTCCGTAAATAAATATCAAATTGAAAAATAAATATGGTATTTTCCGGAAAAAAATTTCAATAAGCAGTTGTTTTTTCTG---AAGATTACTGGTGGAGTAAAGGTaATTATTTTTGTTCGAAC 17 PE (27) ctaA TCCAGAAGCCGTCATTCTATTATATTTTTGTGAACAAAAGGCTCTGGGAATTGCCACAAAACACATATTCGCTTACACT---TGGAACGTATATAAAATTGCaGCAGTATGTTAAGAAGGTGA 17 S1 (28) dciA CAAACATGAATCCTTGAAAGAGGATTCTTTTTTTATCACTGAATGATTGAGATTTTTCCCAGTTATATTGCATTTTTCC---TCTTTTTTTAATATAATTTGTTaGAATATTCATAATTTAGT 17 PE (29) degQ ATTCCTTTGAGTATAAGGACCTATTGAGATTTGCGGTGTCACGCAGGACTTTTTTGCATACTTTTCGGTGAAAAATGAG---CCGAAAGCAGACACACTATTAgTAACAGATCAAATACCTAG 17 S1 (30) degSU TGTGCAGCATGCTAGCTGACCCTCCTGCTAAGCATAAAAGACTGCCTATACAAATTCGTACAGTCTTTAGAATTTTTGT---GCGTATTTTGGTATCATAAAGAGTAGaTAGTATATAAAAAT 17 PE (31) divIB GTGAAAAATACGAGATTGATATGCACACAGAGGTTGAAATCATCGGCGGAAATCGCTGATTCAAGTTCTGACTGAAGCT----GTTCATATGATATACTGTAAGCaAACGACAAACGGCATCA 16 PE (32) dnaA TACCAACCCCTGTGGACAAGGTTTTTTCAACAGGTTGTCCGCTTTGTGGATAAGATTGTGACAACCATTGCAAGCTCTC---GTTTATTTTGGTATTATATTTGTgTTTTAACTCTTGATTAC 17 S1 (33) dnaE P2 AACTCAGGACGCTCTATCCTGGGTTTTTGGCTGTGCCAAAAGGGAATAATGAAAAACAATAGCATCTTTG--TGAAGTTTGTATTATAATAAAAAATTgTGATAAAATGATAAT 18 S1 (34) dnaG ACAGTCTGTCCACATGTGGATAGGCTGTGTTTCCTGTCTTTTTCACAACTTATCCACAAATCCACAGGCCCTACTATTACTTCTACTATTTTTTATAAATATATaTATTAATACATTATCCGT -- S1 (33) dnaK TTATTTGACTCATCAAGGAAATTATTAGGCAATGAAGTTTTTGGCGCTTTTTTTGGGTGAGTTATAATTGACATTTTTC---TTGTGGTTTGATACTTTTGTTATaGAATTAGCACTCGCTTA 17 PE (35) ffhrpsp CGGAATAAATTGGATGATATTTAGCGTATTTTGGAAAAGTTAATCGCCGCTTTGACAAGATAAAAACTTGACAGTGTCA---TTAAAACCGTGTAAACTAAGTTATcGTAAAGGGATTTGACT 17 PE (36) ftsA P1 AAATGTGAAAAGCACATAAAAATATTCTGTTGTTATTTTTTGTTACACACTTGTAAAGCCACATTCATTGTATTGTTGT---TCCGCAAATAATAGAATAGAAATgATCGAAATGTGAGGAGG 17 PE (37) ftsA P3 GTACATATGATGAAATGGTATTTGTTTCCGGTTTCTTTTTTAATATTATATTGGCAATAAGTTTAGCTTTTCTGGGAGT---CCATCTTGGTGTAGACTTGTATTTAGCAGGTATATTCGCAT 17 PE (37) gcaD(tms) TTTTTAATTCTGATTTTTCAAACTTAGTTGCACTCAATAGAAAATTCTTGCACTTCATGAAGTCTCCTTGAAATCAGAA---GATATTTAGGATATATTTTTCTATgGATAAAAGGGATATTG 17 RN (17,38,39) glnR GAAAAGCAATTAATTTAAATTTTTTTAAAATTTCACTGAATTTGATGTTAAGAATCCTTACATCGTATTGACACAAAAT---ATAACATCACCTATAATGAAACTAaGTTAAGAAAAGGAGGA 17 RN (40) glpD ATTGGAAGAAGAAAAACGAAATGAGCTGTATAAAGGCTGGCAAAAAGCCGTGAAAGCAGCTATGGCTTTTAAATAAAGT----AATACTATGGTATAATGGTTACaAGTTAATAAGAACGGTC 16 PE (41) glpFK CTGTAGCTGTCACAACATCTAATACCAAATTGTGGAAAAAATATGAAAACTTTTTGACGGAAAGTGATTGACACCGCTT---TCATGCACTGATACAATTGCACTaGGTTAATACATTGTGAT 17 PE (42,43) glpTQ AAAATATAATTGCATTTAGTAAAAGGATAATATTCACTTCCCTAAGGCCCAATTTGAAAATTACCCGTTTACATTCGCT---CCGGACTATGATAATTTAAGAAAGCGCTATCATGATAAG 17 S1 (44) gltA GCGCACGTCCATGTTTGTCTCACATCCATCTATCTCATTTTGAGATTCTTTTGATCTAAATTATATATTGTTTATATCG---TTTTGAAAACCTACAATGATTATaGAGTTGTTAGATTTTAT 17 S1 (45) gltC TCCTCTCCCCCGATCAATTTCCGATAATACCGGTCATAAAATCTAACAACTCTATAATCATTGTAGGTTTTCAAAACGA---TATAAACAATATATAATTTAGATCaaAAGAATCTCAAAATG 17 S1 (45) gltX ATTTACAGGCCGGGCGGAAGGAATAGCGGCTCAGGCGACAGTACTGATACAAAAAGGCTAACTTGTTTTGATGCCGGGT---CTATTTGGTGGTAGAATAGATTCaTACATTTTTGCCTGA 17 S1 (46) gluB CTTATTCAATAGAGATAGAGCAAATTGACAGGCTTTTACACCTCCCAAAAACAAGAAATTAGGTTGATAGACAATCATG---AGAAAGATTTTTACAATGAGTTCgaGCTCATAAGAAAGAGC 17 S1 (47) gntR TAATTGATCTGGAAATACATACCATGCAATATGGTAAAAATTTAAATAAAAATTAGAAATGAAGTGTTTGCATAAAAGA---AATATTCACGTTATCATACTTGTATaCAAGTATACTCCTTG 17 S1 (48) groESL GAAAAAGCTAACGGAAAAGGGAGCGGAAAAGAATGATGTAAGCGTGAAAAATTTTTTATCTTATCACTTGAAATTGGAA---GGGAGATTCTTTATTATAAGAATtgTGTTAGCACTCTTTAG 17 PE (49) gsiA GGTGTTTGAAAAACCCGTGCTTTTTTGTTGCGGTTAGCCGAAATTCGACAATTGCGGTTATTTTGCGTTCTTCTTTTTC--TTGTAAATATGATAAAATATGACaTaTCTCGGGTAATTCAAA 18 PE (50) gsiB GAAAGCAGACGGACACCGCGATCCGCCTGCTTTTTTTAGTGGAAACATACCCAATGTGTTTTGTTTGTTTAAAAGAATT---GTGAGCGGGAATACAACAACCAaCACCAATTAAAGGAGGAA 17 PE (50) guaA AAGATTCTTCGGCGCTATGGAATGATTCGAGAGAGTTATGGGAAAATTTAATTAAAAGAAGATGGTCTTGACCGCTTAT---CGACGTGTTGTTAGAATTAGTGAaTATTATCGGAGTCTGGG 17 PE (51) gutB AGCGTTTTTTGTATATGAAAAAATAAAAGTACAGTGCCGCTGTCCTTTTATACAGCAGGAAAGGCTGTTGAACGTGTTA-----AAAAGCAGATAAAATGGGGGCaGTAACAGAGAAAACAAA 15 PE (52) gyrB AGGCTTTTTTCTGAACAAGATCAGATGCAGCGATGCCTGCAATACCTATATATTCTAGCAATTTAATGTGTATAATCA--TAAGTTTATTGATATAATGGAGAatagTGAAATCGTATTGAA -- S1 (53) hbs AATGCTTGATATGGCTT---TTTATATGTGTTACTCTACATACaGAAATTCTTCACTTTGT 17 PE (54) hemA ATTGTCAATAGGAATGCTTCTTTTCCCTGAAGCTTTTTCTAATATAGCATAAGAATTTTAAAATCTGTTCACATTTTGTGAAAGAAACTATGTTATAATTATTATAAATAATGAGTTCTATGT 20 PE (55) hsmB1 AAAGAACATGTCTAGACTATCTCTAATTGTGATAAACCCTGCTGAAAAGTACCAGCAGGGTTTATTGTGTTAATCA-TTACAAAAAATGATAAAATAAAAAAGcAAGACGTATCAATATT 19 PE (56) hut TCTTCTGCTTTCTGCGTCACGCTATTACAATAGCAATCTAACTTGTTAAAGACTATAAAAAAACCTTTTGACTTCTGCT---GCTGAACCAATTAATATAATACTCaGTTAATAGTTATCAGA 17 PE (57) ilvB CAATAATGAAAGCGTATACAATATAGATTGATTAATCAAAATTGTCTAATAATTTTAAAAAATGCTGTTGACACTGCGT---CCAAAGCGGCGTAATATGAGTTCaaCAAAAGATAAATGCAA 17 PE (58) kinC TTACCGCCGCCTAAGATAAGACATCAAGATATTTGGTAATGAATGATTTGGGATACTTTACATATTTTACTCAATTATT-TGTCGAAGAATGGTACAATAAGTAGaGAAACACAAGCGGCAGG 19 PE (59) lon S1 TCAATAAAGAATCCGTTTAAACCCTATTTTGATAATAGGGTTTTTTTCATGAAGGACATCTTTTCCTTTTTCATATCAG----AAAGAAAGGGTATACTACGAGGAgACTGTTTTATAGAAAA 16 PE (60) lon S2 CATATCAGAAAGAAAGGGTATACTACGAGGAGACTGTTTTATAGAAAATGGAACCATGCCGTTTATTGTACAAGGATG--AAAAAGTTGTATTATAATGGTTCATaCTAAAGTCACGGAGGT 18 PE (60) lysC GACATCAAAAAAGCCGGTGTTCCGCAGCGGCGGCTCAGCTCCTTTACGACAAATTGCAAAAATAATGTTGTCCTTTTAA---ATAAGATCTGATAAAATGTGAACTaaTTTCATAGTTAGATC 17 PE (61) mecA TGTGACTGTTTTATCATAAAATAGAAATACAAAGGAATTCACACTGGCCTTGGTTAAGGTTAAGATGTGGACGGAATGG---GTAAAGTGTAGTAAAGTACAATTAaTCGGGAGCTTAGATGT 17 PE (62) men AAGCTTGTTTCTTTTTCATTTCTG----AAATTAGGTTTATAATAGGTAAgGCAGGCCATTTGGACTG 16 PE (63) menB TGGAGCAGCCGCGATTGGTTTGGTAAAATAGTGAGTGAGTTTTGACAAGCATCTGACTCATTCACATAGAGAATAAAA---GGAGGTCATCATATGGCTGAATGGaAAACAAAACGGACATA 17 PE (63) menE TTCCGTGATCAGCAATATCTAGTAAACCAACAGCTTGAGACTTTGCGGTCCAAGCTGTTTTCTTTTCAATACAGACATT----TTACCTCGGAGATGATGACATGCTGACAGAACAGCCCAAC 16 PE (63) nadB GGCGTTGTCGCTGCATAATCTAAATAAATCATCCGGTCTTCCTCCATCCGTTCTCCATAAAAAACTCTTGAGTTTATTT---TATCCTTGTGTAAATATAGGTGTCaAGACAGGTGTAAACA 17 PE (64) nasA CTATTAAAAATTATGTCACAATGCATTGTTAACGCATTAAACGTGTCACAAAAACTTACACATGTCTTTTCCAGAAAAT----AATGGTCCTATATCCTTGATTCaGAAAATGTAAAATAATG 16 PE (65) nasB TTTCTGAATCAAGGATATAGGACCATTATTTTCTGGAAAAGACATGTGTAAGTTTTTGTGACACGTTTAATGCGTTAACAATGCATTGTGACATAATTTTTAATaGGAGAAAACTTACGAG 20 PE (65) nifS CCCCTGAACCGATGACTGCAATCGTCTTTTTAGACATATGCCATCCTCCTGTTGTTTACACCTGTCTTGACACCTATA--TTTACACAAGGATAAAATAAACTCaAGAGTTTTTTATGGAGA 18 PE (64) nrgA TCGATAACATTTCTCAAAAACCATGTCAGGAAATCTTACATGAAAATGTTTTATCAT---TCTTTTTTCTCTATAATGAAGAAaTaTAATAATTGCTTTTT 17 PE (66) nusA AAAAAGTGCCATCGTAATATTAGAGTTTCTGTCACTTGCTTAGGTATGAAGGTAAGCGTATATCCATTTGCAATAAAAA---TATGGTTATGGTATAGTTTTATtgGAAATGCTAACGATTA 17 PE (67) odhA ATGCTTTTTGGCGTTTGTTTTTTCGAATGATTAAATTTTTTGTTTTTTATAAAGGTTTTTTACTATTTTGTGAACAATC----AAGGTAGAATCAAATTGCAAACAGtGGTAAAATATCGTTG 16 PE (68) orfS AGTATTGTATGTATTCTGTTTGATTTTCCTATTTCCTTTAATTATAATAGTCTACTTTACGACATTTTCTGAGCATTT--TCTCTTTTGTTGTATACTGATATTGTACGTTATAAAGGAGGA 18 S1 (69) pbpD CGGAAAGATTCTTATGCCAAAGCAAGCTGATTCCGAGAAAAAACTAAGGAATCTTCTAAATTTAACCTTCTCGTAATCT---CAAAAGAATGGTACGATATGGCTaGAATTTAGGAGAAAAGA 17 PE (70) pbpE AATAGTGAACGGCAGGTATATGTGATGGGTTAAAAAGGATCTCTAACTGAAGGATTTTTCAAAATATTTGAAACGTTAG-TAGGTTAGTAACGTACAGAGATATgGGAGGTGGAGGAATGA 19 PE (71) pbpF TACGATCGTTTTTAAAAAATCGGCTGTCCCATATGTAATATAAACCTTCATATCAGCCACCTCCTGCTTGCTAGTATAT---CAAAACAATGGTATAAGTTTCTATTgGCGAGTGCTTCGAAC 17 PE (72) phoA AGGCAAGATAACGAAAAGCGTTTTTTCATTTCCTTACAAGGCTTTCATTATTGTTTACATGATCAACAGCCGCATTTAA---CAAAGTTTCCCTAACATGATAAACgGAATACATTAAAGGAG -- PE (73) ppiB TTATTTTTTAGTAAAGCTCGGGAGATTCGTTTTCCCCCGAAAGGTGTGGTATAATAGCCGCGACAAGGAGAGACAGGCT----ATAACCTATACATAATCTCCTTTgAAAATTAAAATAAAGA 16 PE (74) ptsXHI GGTTCAGTCAACAGAGAACAAGAAGATATTGTGAAGATTGAAAAATAAGGGTGTTAGTACGCCGTGCTTGTCAGATGAC---AAGTACGGTTGTATGATATAATaTTGTGAAGTAATAAAGCT 17 PE (75) purA AACGCTTATAAAACGAATGGAAGCGAACGAATATAGATTTACAATAAATTAATGTTCGGATTTACAATTGACTTTCTGT---TTCTTCACTGATAAACTTGATTTgTTTGAATAGAATCGTTT 17 PE (51) purF TTGAAGGGAAATTGATCTAAAACACGAACATTAGTAGAATGAATTTTTGTATCGTTCGATAATATCGTTGACATTATCC---ATGTCCGTTGTTAAGATAAACaTGAAATCAAAACACGACCT 17 S1 (76) pyr TCGAATTTTGAAGCGTCGCGTTCCCGAGGATATGGCAGAATTAATCGAAAACCTCAGAAAAAACGGTTGACAGAGGGT---TTCTTTTCTGAAATAATAAACGAAgCTGAATAGATTCTTTA 17 S1 (77) rbs GAGTGAAAACCTTAAATTTTTCAATTATATATACAATTTACAATTAGATTTCTTTTGATATTTTTATTGCTAACTTCG--GATTGTTCATGATAATCTATCTATgTAAACGGTTACATAAAC 18 PE (11) recA TGATACATTATGATATTTTGATAGGAATCACGCCAAGAAAAAATCCGAATATGCGTTCGCTTTTTTCTTGGCAAATCCC---TTCAAACAGGGTATAGTATATgtAGTGGTAACATAAAGGAG 17 S1 (78) ribG ATTAAAAAACATCACTTTCGGATCGAAGGGTGATGTTTTGTTTTTCTCAAATTGTAAGTTTATTTCATTGCGTACTTTA---AAAAGGATCGCTATAATAACCAATaAGGACAAATGAATAAA 17 PE (79) rpmH AGGTTTCGAAAGTTGAAAAGGTATGGTATCCTATTATGGTTGCAAGAAATAAAAGCACTAGTGAAGTTGACAATGAAT--AGGTAACGCAAATATAATAAGTAAGACtgtCTTTAACAGCTA 18 S1 (80) rpsd ACCTAAAAGTTTACCACTAATTTTTGTTTATTATATCATAAACGGTGAAGCAATAATGGAGGAATGGTTGACTTCAAAA---CAAATAAATTATATAATGACCTTTgTGTGAAATATTGCAGC 17 PE (81) rrnA P1 GCGTTAGTCGTCATTAAGCAATTTATCATTTAATTGATATTATGTATTGACTTAGACA---ACTGAAGGTGTTATTCTAATATCGCTGATGACGAACAGCTT 17 S1 (82) rrnA P2 CTGAAGGTGTTATTCTAATATCGCTGATGACGAACAGCTTTTTTGAAAAGAAAATGCTAAAAAGTTGTTGACAGTAGCG---GCGGTAAATGTTATGATAATAAAGTCGCTTAAAGGAGCGGT 17 S1 (82) rrnB P1 CACACGCTTTAGAAATCATGGCGAGGATTATAGTTTATTTGTTTTATAGATTTTTTTTAAAAAACTATTGCAATAAATA---AATACAGGTGTTATATTATTAAACgTCGCTGATGCACAGCG 17 S1 (83,84) rrnB P2 ATTATTAAACGTCGCTGATGCACAGCGGACACAACTAGATGCTTCAAAACAACTTGAAAAAAGTTGTTGACAAAAAAG---AAGCTGAATGTTATATTAGTAaAGCTGCTTCATTGAGAAGT 17 S1 (83,84) rrnD P1 AACGTCTGCCAGATAGAAACGAAAGGACAGGCTGTCTATCACCGAGGATATTCTTTTAAAAAAGGTGTTGACTCTGATT---CTTGACCGTGTTATATTATTAAACGTCCTGATGCGCTTCTG 17 -- (85) rrnD P2 TTAAACGTCCTGATGCGCTTCTGAGAAAACAAGCTCACAGCGGCGGGAAAATAAATCAAAAAAACATTTGACAAAAGAA---AGTCAAAATGTTATATTAATAAAGTCGCTTCAACAAGAAGT 17 -- (85) rrnG GTTTCCCCCTGACAGAGTAGGACGCCGCCAAGCAATTGCACATTAGTGTAATTTTTTAAAAAAGTTATTGACTTTGAAG---AAGTGACATTGTATACTAATAAAGTTGCTTTAACAAAGCGG 17 -- (86) rrnJ P1 AAAAAAACTATTGCACTATTAT---TTACTAGGTGGTATATTATTATTCGTTGCCGCTAAACAAGG 17 RN (87) rrnJ P2 GTGGTATATTATTATTCGTTGCCGCTAAACAAGGCGATAACGAAAAAAAGAACTTCAAAAAAAGTTATTGACTTCACTG---AGTCAAGGAGTTATAATAATAAAGTCGCTTGAACGAAGTGA 17 RN (87) rrnO P1 AGAAGAACAAGAAGAAGTGTGAAAAAAAGCGCAGCTGAAATAGCTGCGCTTTTTTGTGTCATAACCCTTTACAGTCATA----AAAATTATGGTATAATCATTTCTgTTGTCTTTTTAAAGAC 16 S1 (82) rrnO P2 TTTCTGTTGTCTTTTTAAAGACACAAGCATGACCATTATGACTAGTAAAAACTTTTTCAAAAAAGTATTGACCTAGTTA---ACTAAAAATGTTACTATTAAGTAgTCGCTTTGAGAGAAGCA 17 S1 (82) rrnW TGCTTTGCACGCAGGAGGTCAGCGGTTCGATCCCGCTAGGCTCCACCAAAAGTTTTTAAAAAAGTTGTTGACTTTGAAG---AAGTGACGTTGTATACTAATAAAGTTGCTTTAACAAAGCGG 17 -- (86) sacB TCTTTAGGCCCGTAGTCTGCAAATCCTTTTATGATTTTCTATCAAACAAAAGAGGAAAATAGACCAGTTGCAATCCAAA---CGAGAGTCTAATAGAATGAGGTCgAAAAGTAAATCGCG 17 S1 (88) sacXY AAGGTTTTTTTCATTCTAAGAACACCACACACAACCTTCCCATCCATTGTACAGGCTTTTCATACTATTGCTATACAGC---CATGAACAGCATAAAATGAACGTTaTTACAGTTATCACATA 17 PE (89) sdh ATTGATAAAATAAAATTTTTCAATCAACTAATCAATTCGGAAAATTATAATTTATGTACGCGTTTTCTTGACGCCCTTT---TGAGGGAGGAGTAAAATGAAATTgTCAATAAATCTTAATAA 17 S1 (90) sigB ACAAATCAGTTTGGCACTCATTGATTTTTAGACATATTTGCAGGTTGCTCAAATAGAGCAACTTTTTTTGTTTTCAAAA---AACATAAACGATATAATAGTgAaaTAACGAAAAAATATGTT 17 PE (91) spa TAAGCAAAAAGGATTCTTTTCTGAGAGGGAAAAGAGTCCTTTTTTTATGGTATTTACTGGGTGGATCTTGATATTTTTTTGATTTTTAGAATGTATAGTAAAAATAgAGTATTGTAAATATTT 20 PE (92) spo0A TATTTATGGAAAAGAAAAAGCAAGCTGACTGCCGGAGTTTCCGGCAGTTTTTTTATTTTGATCCCTCTTCACTTCTCAG---AATACATACGGTAAAATATACAAAAgaAGATTTTTCGACAA 17 S1 (93) spo0B TCTGCCTGGCTGCAAATCAACCAAAGCCAGAAAAAAGGAACATGATATTTCTGGGAAAAACAATTGTTTTTCTAACAAAGCCTTCTCTGTTATAATTCATAATaCACACTTATACAGACT -- S1 (94) spo0E ATTGTTCTTCTAATCCTATCAATATATCTATTATACCTGAAAAATTAACTTATTTAATGAAAATATGTTTACAAATAAA---GTATAATCTGTAATAATGCACAATAaCCCAATCAAACTTGT 17 PE (95) spo0F ATTTTCAACATAAGTGAATCCTCCTTTATAACGTACAATATCAGTATACAACAAAAGAGAAAATGCTCAGAAAATGTCG-TAAAGTAGACTATTATAATTAAAgGAAATAGGAAAATCAAACA 19 S1 (69) spo0H AAAATTGCTTTATCGGAAGAGGTTTTGAAAACGTTTGAAAAGTGGAGGCGGGGAGACTTAGATTAAGTTGACGCTTTTT--TGCCCAATACTGTATAATATTTCTaTCTACGTGCGCCGGGGG 18 PE (96) spoIIE TTCTTTTCATAAACGAATATCAAGGCAGAAACCGTCGAAGATTTCTTTGGTATTGTTACCTTCTTTTGACAAAATCC-TATCTGTGCTCGCTATAATGACAGGCAaCGAATATAACAGGTG 19 PE (97) spoIIG TCGACAAATTAAGCAGATTTCCCTGAAAAATTGTATTTTCCTCTCAACATTAATTGACAGACTTTCCCACAGAGCTTGCTTTATACTTATGAaGCAAGAAGGGGAACAGCG -- PE (98) srfA AAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACA---TTTTTTTCATTTAAACTGAACGGTaGAAAGATAAAAAATAT 17 PE (99) tet GCATCACCCAAATTTTTATAAAAAAAGTAAAAGTTTAATCCTTAGT----CTATATATAATAAGATCATATCaATCAAATGTAGGGGGAG 16 S1 (100) thrS TTTAAAAAAAAGGAAACGCGATCGTGTTGATTTTTTGG---ATTGAACAATTTATAATACATaggAGATTAAGAAAGACACA 17 PE (101) trnS GACGAATATGCAAGCCTATGTTACATTATAAAAGTCGTCACGAGAGATAAATAAAAACATTTACCTCTTGACACTGCAA---ATCAAGGCTGATATAATAAGTCTTgTCTCATTATTCCACAG 17 RN (102) trpE GTCCCTCAGGATCAGATCAGACATGTATATTTAGAAAAAGTTGTCGTATTGAGGCCCGATTTATCATTGACAAAAAAT--ACTGAATTGTAATACGATAAGAACagCTTAGAAATACACAAG 18 S1 (103) tsr GTCAAAAAATATCTGCCCCTGAAGTCTAACTGACAAAAAGAAGAAACAAATGAATCATGTCATTCTGTTGCCGATTTGT---CGAAAAGTTGGTATCCTAGTTATgGAGAAAAAGCGATCTGA 17 S1 (69) tyrS GCTGAAGGCATGGGAGCTTAATCTGCCGGCTGGAGATCTGTCAACAATGGAGGATTAAAAGGCGGCGTTGACACAGGAT---TTTATTTATGTTAAAAATGATATaGCTTCATATGAAAAGGT 17 PE (104) veg CATAGAATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATG---GGCTCGTGTTGTACAATAAATGTaGTGAGGTGGATGCAATG 17 RN (17,105) xylR AACTTTCTGAAAAAGATGTTGAAAAAGTCG---AAAGGATTTTATAATATTAAGTCAAGTTAGTTTGTTTGATC 17 -- (106) f01epr ATTGAAAGAATTAACGAGCATACAGTAAAATTTTATATGTCTTACGGAGATATTGAAGATCGCGGTTTTGACAGAGAAG------AAATTTGGTATAACCGTGAGCGCAGTGAAGAACTTTTC 14 -- (107) f105 TTGACGGAAATACAAGATAAATACTCTCTGAATCTTTAAAATGCTTGAATTTCGTCAAATTTCGACTTTTACAAAATGT---CGTGAATACCATACAATTTAGACATACCTTAACGGGAGGTG 17 -- (108) fspp1epr GCCTAACCTACCAAATTATTCAGCTGAATGAAAATATTTCATCTTTTTTTAAAAATAGTGGTTGCCTTTCTAT---GTTTTCTATGTTTTAATAGAATCATAGAGAGGGGGGGACAA 17 -- (109) f01e22 CCTTGGGGGGTACAAAGAGGTGTCCCTAGAAGAGATCCACGCTGTGTAAAAATTTTACAAAAAGGTATTGACTTTCCCT---ACAGGGTGTGTAATAATTTAATTaCAGGCGGGGGCAACCCC 17 RN (110) f01e3 AAAGATGTTTTGTTCTACATCCAGAACAACCTCTGCTAAAATTCCTGAAAAATTTTGCAAAAAGTTGTTGACTTTATCT---ACAAGGTGTGGCATAATAATCTTaACAACAGCAGGACGCT 17 RN (111) f105epr AGAGAGTATTTATCTTGTATTTCCGTCAATTTACTAAAAAATACTTGTATTTCCGTCTTTTTTAGTATTGTATTTCCGA---CATTCGGATACTATAATTGTGTCATGCCACAAGACACAGTG 17 PE (112,113) f29 A1 GGAGTCCATCTAATTGTAGAAATAAACGATCAAATCGTTTTAGAATGGGAGAATTAACTATTAATGTTTGACAACTATT---ACAGAGTATGCTATAATGGTAGTaTCAATGGTACGGTACTT 17 RN (114) f29 A3 CAAATCCTTATGTATCAAGGGTTCACGTGGTATAATTAAGTAgTACTAATAGATTATA -- PE (115) f29 B2 ATTTCCGATACACACAAAGC-CGTATAAACCGTGTATAATAGGGgtAACCCGCAGGGAAAGG 19 S1 (116) f29 Ec3 TTGATCTGTATGAGCAGTCAAATATCCGCATTCCTAGTGACATCATCGAAGATTTGGTTAATCAACGTTTACAAAGTGA---ACAGGAAGTGTTAAACTATATAGagACACAGCGGACATACT 17 S1 (117,118) f29 G2 AGAATCTAACAACTAAATCACGACTATATACCTATACTATTTATTATCATCAATTTGTCGAAAAGGGTAGACAAACTAT--CGTTTAACATGTTATACTATAATAgAAGTAAGGTAATAAGAC 18 RN (117,119) f29 G3a AACCCTTGATACATAAGGATTTGTGGGCGTTCTTGTCGAAAAACGTCAACATTTTATAAAAAAGTCTTGCAAAAAGTT--ATACAGGTGTGGTTAAATAGAGAACgTAGACAACAACCTTTT 18 PE (114,115) f29 G3b GAGAACGTAGACAACAACCTTTTATTAAAACCTTGTAAAACTTTGTCGAACTTTTTATAGAAAAGTGTTGAAAATTGTC---GAACAGGGTGATATAATAAAagAGTAGAAGAGATACAGAGT 17 S1 (114) f82-129 GAATTCCCCGGATCCGTCACCCCTAAGAAAAAATATCTACAGAAAATATGAAAAAGTTGTTGACATTTCTT---CCCATCCATGCTATAATAAAGTCaTAGAGAACAACACTATC 17 S1 (120) f82-156 CACGTTTTGTTCTACATCCAGAACAACCTCTGCTAAAATTCCTGAAAAATTTTGCAAAAAGTTGTTGACTTTCTCT---ACGAGGTGTGGCATAATAATCTTaACAACAGCAGGACGCTA 17 RN (120) fsp82 CTTTTTGTACATATTGATTGACTTCTGCC---ACCAAGTGTGCAATAATTATAGTAACATCACAGAGAAATAG 17 -- (121) fsprmtas TATTTGGGGCGAATTAAAACCCAAAGAGCCAGGGTACATTGGATATTTTGTACAGACTGAATAAATGATCAATTTTATTTAGAGTAAAAATAAAATATaTgGAGGTTGTTTATTGGGTAA 20 S1 (122) (B) PUTATIVE PROMOTERS (WITHOUT BIOCHEMICALLY MAPPED START SITES) aadK AGCTTAGAAGAATACATCACATTCAAG--AGTAAAAAAATCTATAAGACGTTTTACAGTTAGATATTAA 18 (123) alsR AAACGTAAAATTTTAAATATCTTGTGATAAGTTTCACTATACACTCTTTGGAAATTGACCTCCAATATCGATTCGACCT---TATGATTAATATGTAATACGAATTATTAACCTATGGAAAGG 17 (7) amyla AGCGAGGGAAACAGTCTCGGGCAGTTTTTATAGGAACATTGATTTGTATTCACTCTGCCAAGTTGTTTTGATAGAGTGA---TTGTGATAATTTAAAATGTAAGCGTGAACAAAATTCTCCAG 17 (124) ansR CGCATACTTTTAATGCAATTATAGACACGGAAAATAAAATACGCAAGACATTATTATTCAATTCGCGTACACTTCCTAA---TACCTATATGATATAATCAGCTCAAGGTGAAAAAGGAGCGG 17 (125) app TGCAATGCTTTAAAAGGATAAAATAATGGAATTTCATTAATAATATTACATTTATCCTAAAAAATTCTTGATTTTGCAA---AATGATTGTAATAATATACAACTATAAAATTTTTCGATAAT 17 (126) aroC TCCGATTTCCTTAAACTAAAAAGAGCCCTTTAAGGCTCTTTTTTAGTTGCTATTCATATAATAGAAATTTTCAAAAAAA---AGTTGTACGTGTATAATAAAACAAGGTAAAGATTGAAAGGA 17 (127) aroI CCTGCAGAAATGTTGTACAATGAATGTCATTCAGGCAAAAATGGCTACAACAAAGCGCACTATAAGCTTGACCGGTAAA---GCCGGTATCTATATAAATATTCGCTAAATAAGCATATAATG 17 (128) betaM CCCAGCCTTGTCCGTTTGTGGTGCGGTTCAGCTTTTCATCATGCATGACGATCAGCTTGCCGTCTTTTGTCATTTGTA--AATCCAGCTCAATATAGTCAGCCTTCATTTTTTGCGCAGTTT 18 (129) bglu TTTTTCAGAGGGAAGATGATGATAGTTACAGGATTCAAGTAAGTAAGATTCGGTATTATCATTATTTTGGCCGATGTT--CCCTTTTAAAAGAATCATGTAAGATCAACATAGAAAACGCTT 18 (130) bmr2 GGCAGAGCTTCGAAAACTCCCCTGTTGTGAAATACTTCTTAACATCTTCGCTCATAAAAACCTCCTTGACTATACGG-TAACCATATACCTTATGATTTGATTGTACTTGAAAAAAGCTTC 19 (131) bmrx ATATCGACATGCTTGTTCCCGCAAATGAATAACTGTCATAAGGCTTTAGAAAGATTTTGCAAATCCGTTGACTCTCCCC-TAGGAGGAGGTCTTACAGTATAAGGGATACACACTTGAAAAAG 19 (132) cad P1 TTTTCTTCACTCCTTGTAGATTTACTTCCCTTAAGAGAAAGCATCTTCATTTGATCATAAATTGTTCTTTACATTCTTT---CAAGTTCATAATATAATTCATTTGTTTTACGTCTAAAAAAC 17 (133) cad P2 CATAAATTGTTCTTTACATTCTTTCAAGTTCATAATATAATTCATTTGTTTTACGTCTAAAAAACGGTTGAGAAACTGA-TTTTAATACACACTATTATGCATAGGTATGATTACAAAGGTGG 19 (133) cccA AAAATGATGTCATTTGCAAATGAACATTGTGGTGAAAAATTTCAAAATCTAATTCCATATTTTCTATTGTAAGCGTAT---ACAATACATTATACAATAGAATAAAAAGGATATTAGAGATT 17 (134) ccpA AAAAGGCCGCGCCTGCGGCCTTTTTTTATGCTTTCTCGTTTATTTAGTTATAAAAACCAAGTATACGTTTTCATCATCT---ATAAAAACGTGTATAATTTCATGAGAAGTAATTAAATTTGA 17 (135) cel14 CTGAACAAGACAAAAAGAGCAAATTGGCAGGCTTTTAAACCGCCTAAAAACAAGAAATTAGGTTGATAGACAATCATG--AGAAAGATTTTTTACAATGAGTCCGTGCTACAAAAGTGAAAG 18 (136) cheR TGGCAGTGTGCATCAGACCTCTGCCTTTCCCAACGATCTAAAATCAGCTGAAAAGCTGATTTTTTTATTGAAACAATAC----AATTTCCTGATAAAACAAGCTATACTAGGACAAAAAGACA 16 (137) cmcase TCTTATTCAATGGAGATAGACAAATTGACAGACTTTTAAACCTCCCAAAAACAAGAAATTAGGTTGATAGACAATCATG--AGAAAGATTTTTACAATGAGTTCGTGCTCATAAGAAGTGTA 18 (138) comE2 CTAAGGTTTCAGGAATAGGTGAAAAGTCATTTGAGAAAATAAAGTCTTCCATTACAGTAAAGTGATTTGACGGTCATG--CATTATGATAGGTAAACTAAAGGTCAGGCAACACAACATTTG 18 (22) cysE ATTTACAGGCCGGGCGGAAGGAATAGCGGCTCAGGCGACAGTACTGATACAAAAAGGCTAACTTGTTTTGATGCCGGGT---CTATTTGGTGGTAGAATAGATTCATACATTTTTGCCTGAGG 17 (46) cysk GACAGTTAAGACACTTTGGAAAGAAGCCGATGTATCTTGGTTTTATGGGGAAAAAAGTACTAAGTGATTGACAAAAAAT---TTTGAAATTGATAGATTATATACATAATACCAATACAAATA 17 (139) dat1 GACAGAAGATAAATTAAAGCGACTTGGTGAACCGTTTTATACGACAAAGGAACGGGGAACTGGACTTGGGCT--TATGGTAAGCTATAAAATTATTGAAGAACATCAAGGCGAGAT 18 (140) dinA CAGCTGGAAAATAAAAAACCACCGAACTTTAGTTCGTATTTTTAGTGAATTTTG--CTTCCATTGTGTTACTATATCTATAGGAAGATTTCGTTAAAG 18 (78) dinB TTATGTTCAATGTCAATTAGTTTATTCCTCTAAACTATATATGTCAACAAATTTTATTTTCGAGCACTCTACATAAGAA--CTCATGTTCGTGTATAATGAAAGCTATACACACGAAAGGGGG 18 (141) dinC TTCATCGAAAATTTAATAAGCTAAATGATGACACTTGTTCAAAACAGAACAAGTGTTCTTTTTTCTATTGAATACCGAA---CGTATGTTTGCTTTAATGTAATTAGTTGCTTATGGCAGCAA 17 (141) dnaB TAAAGAAAGAGCGTTAAAAGAGCTAAGAGGATTCTTCTAGCTCTTTTCTCATGTGCAAAATTGGCATTTGATAGATATA----AGAAACGGTGTAAAATGAAAGGTAGAAACAAATTCGGAAG 16 (142,143) dnaZX AAATCAATCATCAAATTTTCAGACTCACCTAATATTAGGTGAGTTTTTTGTTATGTAAAAAGAGCTTTTGGAATCGAAA---CAAGGTTCATGTATAATGGGAATGATGAATAACGGAGGAGG 17 (144) dnpop GACTTGGAGAAGTAAGCTCTGGGCAGGTCCGCGCCCAGAGCGTTTTTCAGTTTCTTAGAAATCAGGTGGATGAAAGCC--GGCGCCAGCCTGTATAATAAAAGCAAATCAAAAGCAGTTTTA 18 (145) dra GCGAGGGCGCTTGTTAATGATTTGTGACACGTTCAAACCTTTCATTGAACAAAATTTCAATTACCAATTTACATATGTT---CAAAAGTCGGTTATGCTAAAAAATATCTTAACAAAAAAGGA 17 (145) eglS CTTATTCATTGGAGGTAGAGCAAATTGACAGGCTTTTAAACCTCCCCAAAACAAGAAATTAGGTTGATAGACAATCATG---AGAAAGATTTTTACAATGAGTTCGTGCTCATAAGAAGTGTA 17 (146) feuA CGCATCGTTCAGCAAACTGTTTCTTTACTATCCGGAGATTGTCCATGATAAATCAGGAATTTGTCCATGGTGTTATAT--CTGTTCATTCTCTATAATTCCAATTGATAATAGTTATCAATT 18 (147) fhuD ATCACTTTTTTCAGCTGATTTAATAGAGTGTTTTGAACAAAAATGAAAATGCATTTGCAAAAATATCGTGTCAACCGGC---ACTTGCAGTGGTATAATCACAGATGATAATGATTCTCTTTT 17 (148) glpP CAATGTCATCCACGTTGCGCCGCCATTTTGCCTGACAGAAGAGGACCTTTCCTTTATCGTGAAAACGGTGAAAGAAAGC----TTTCAAACGATATAATATAAAAGTGAATTATTAAAGGAGC 16 (149) glpT AAAATATAATTGCATTTAGTAAAAGGATAATATTCACTTCCCTAAGGCCCAATTTGAAAATTACCCGTTTACATTCGCT---CCGGACTATGATAATTTAAGAAAGCGCTATCATGATAAG 17 (44) grpE GACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCA--CCAACAAGTCTGTATGATGAATAAGGGAATTTTGGCAAATTT 18 (150) hom AAATAAAGAATCTTGTCATATCAATGCGTTAAGCGTTTACATTCGCAAAATTCAGCCTAATGATGTCTTGTCAAAACAG---GAGCGGGCTTATATAATGTTTGTAACTTATATGTCTGTGTT 17 (151) hsmF1 AAAGTAAGCACTACGTATCAATATTGAAATATACGGACGTTTTCGTTTTTTGGGGTTATAATTCAAATTAATAGTGCTA-----TAATTTCCGTATAATATTAAGATAAAAGGTGATTGCAAT 15 (152) hsrB1 AAAAGAACATGTCTAGACTATCTCTAATTGTGATAAACCCTGCTGAAAAGTACCAGCAGGGTTTATTGTGTTAATCA-TTACAAAAAATGATAAAATAAAAAAGCAAGACGTATCAATATT 19 (56) hsrF1 AAGCTTGGTAAAAATGAAAATGTTAATACTGACATTTTAATAAAAGTATGTAAGGCTCTTGACTGTGATA-------TTGCTGATATTATGGAAATTGTTAGTAAATAGTATCT 13 (153) ilvA GGACCAGAAGTAGCAGCAAGATTTGGTGGACATAGTCTGTATTTTTTTAATTATTAAATAAAAATAATTGTCTTATTTTTTGAATATTCATGTTATAATGGCATATTAAATAGGGATTTAAAA 20 (154) ipa27 AAGGGCTGTTCTGTAAAAGGACAGCTTTTTTGCTGTCCATCAAGGTTTTCAGACCTTCAAATTTTAATTGACAAAGGAC----AGGAACTGGCTATGATTATGTTATACAATGATAATCATTT 16 (155) katA TGTTACAATTTCGATACTATATATCGATTAATAGAGATAACTATTTTATAATAATTATAAAATAATATTGACTTTTTAC----TTAGAGATGATATTATGTTCTTATAAATTCCAAGAGGTGA 16 (156) ksgA CGATGGGGAAATAAAACAGTCAAAATTAAAATCTTAAATTAGTATATACTTATGTATTCAGAGGGTTTTGCGCCCTCTG----TTTTTTTCGTTATAATAGACAAAGTGCATTTTCTGCTTAT 16 (139) leuS GACGGCTGGTGAAAGTCAATCAAGTTTGTTTCCGAACTCACCTCAGAGTTGCAGCGGTGAAAAGCCCGTGACGCATAAC---TGCGTTAAAAGTATCAAGTGAGTGCGGCGTATGCCGCGCTA 17 (157) lexA TTCGCATTTTTATAATTTCAGTATATACGAACAAACGTTTCTGTCAATTGTTTTTTCGAACCTATGTTTGTACTGTAAG---GAAAATCATGCTATAATCTTCTTAAAATCGACGTTTTGAGG 17 (158) lipase CTTTTTAGGACCAATAATGACCTCTGAATCTTAAAATTTCTTTAAAAATAAGCCAAAATTACCCTTTACTTAATTA---ATTTGGTAACGTAATATAATTGGAGAATTTGTTACAAAAAA 17 (159) lys dec TGATGGAAGGCGACCTGAAGCAAAAGCTGATTACAATAAAGGAAAGATGATTACCAGTAAGTCTGGCTTTAAGTTCTGT---CAGAGGCACGATATAATAAGGTGTAAGAAGACACATTCAAA 17 (139) lysA CAAAAGTAAGACCCAGCATCGTTCACCCCAAAAATCGCTTAAGGCAGCCTACCAATTCATAATCGCATTGAAACTGACT---GAAGAGTATGATAATGTATGTCTTAATTATGAAGGGACAGT 17 (160) lysRhom ATTCATAAACAATCATCCTTTATTTCTTACGAATTCAAACATCCTCGAGTCTGTTTATATTATTATCTTAGCACCGTTG----ATATATGTTGTATAATGCATATAAAATATCCTTTTCATGC 16 (139) metS ACTTTTTTTATTTTCATTAAAGATTTTTAATTTTAATTATTCTTTTTCAGGGCGTATGTATATATTCTTGATCTTAAAG----GCTAAGATGGTATCATAGATAAAGGATAAATATAAATAAT 16 (139) mrgA GCGTGGGAGTCTATCCTGAAGAAAAAGCTATTCAGCTGATCTAAATTATAATTATTATAATTTAGTATTGATTTTTATT----TAGTATATGATATAATTAAGTCAACAGATCACAAGGAGGA 16 (161) mrgC GAATTCGCGCAGAAGACAAAGCATTACAGGAATACAGCGTAAAATAGCGATTGAAAATCATT---CTCAACCATGTTAAAATGGGTTTGAAAAAGATTCTC 17 (161) mtrAB AGAAAAGCCCCTTTCTAAGGGGCTTTTCATATTTCAAGAGCATGGGCTTCCTGACAGGGCATTCACTTTGCTTTTAGCG--GGGCATATGTGCTAGAATCGAAATTAAATGTATTCATTGGTG 18 (162) np TGATATTATTCAACAAAAACAAACACAGGACAATACTATCAATTTTGTCTAGTTATGTTAGTTTTTGTTGAGTATTCCA---GAATGCTAGTTTAATATAACAATATAAAGTTTTCAGTATTT 17 (163) nprB CGAAATATCTCTGCCCTTCTTTTTTGGGAAAATAAGAACGAAGCACCACATACAAGTTTTTGTATTTTTGATAGGATGA----AGAAAAATGGTAGATTCGGAAGGATGTGGTGTTTTGCGCA 16 (164) orf17 TGATCATGTCTACAATGAGAAGGGCTTTATCTGCTTTGGACAATCGACAGTCTCC-TTTCCGTTTCAGTTATAGTTAATATGTAGCCTTTTTAGGCAAT 19 (165) orfX14 AAGGCTCAGAGCACTGGCGGATCACGGTAAAAACGCTTTCTAAATTTCACATAACCTTCAAAAAGTAAGAAATGTGAAATGAACGTGCAATGATATAATTGAATGGATCTGCAATAGGGGGCA -- (127) pab CAATTCGATTAAAAAAAGCCAAAACTCCCGGTTCGCCGGGAGTTTTTTTATATTTCGTGCATCAAATATGCCATGTCTG----CGACGAATGTTATTCTTGGAAGAGAAATTCACTTTTTTCA 16 (166) pcp GGTTGGGAATAACTGGCGATACTGCTCCGGCAAATGCTCCATTATGATTCACTCCTTTACATTATTTTGATGAAAAACCCATAAATAAACAATAGAATAAAAGAAAAAGGAGATGGGAGA 20 (167) pdhA ATTAGTTTTTTACAACTTCGAAATAATACAGTTCAAAGCAGAGTGTAACTATCCTACATAAAAGGTTTTGGCAAACTGG-GGATCGGCTAAAATATAATACGACTTACTGCTGATACTTTAGG 19 (168) pdhC CAGATACAGTATTTCCTTTCTCTCAAGCGGAGAGCGTATGGCTTCCAAACCATAAAGACGTTCTTGAAACAGCAAGAAAAGTGCTTGAATTTTAATCAAACTGCATAATCGAGAGGGAAG 21 (168) pdhD CGTGATGGCGAAATCGTAGCAGCTCCAGTCTTAGCTCTTTCTCTCAGCTTCGACCACCGTATGATCGACGGAGCAACTGCGCAAAATGCATTAAATCACATCAAGCGTTTACTGAACGAT 20 (168) pel TTTTTTTGCGGTCTTTGCGGTGGGATTTTGCAGAATGCCGCAATAGGATAGCGGAACATTTTCGGTTCTGAATGTCCCT---CAATTTGCTATTATATTTTTGTGATAAATTGGAATAAAATC 17 (169) penP TGTTGATTCTATTCTTATGCCCTTGTTCTCCCAACTTATAAAAATATAAGATCAATTGATTCTATGTTTACTAGCGGC--AAAGGGGTTTGTTACACTAACTGTCATGGGAAACATTTCAAA 18 (170) pheS TCACTAAACGTTGCGGTTGCGGCTGCCATCCTCGTGTATCACTTGCGAGGATAGTGTTGCGCCAAGCG---TTGGATTTCTCTATAATAGAACATAATATTTCAAAAACCGT 17 (171) phoP TTTTACTATAAATGAAAGCGCTATCATAAACGTCTTTATTTCTTTTAAAAATGATGTAAAAGGCGAATTGTCGGAATGT---CCTGCTTTCGCTAAAATAAAATCATGAAACATGTTAAGATG 17 (172) prkA TTTTTCCGTGCTGTCCGAGTCTGGATGATTCTGTATTTTTCTTTATTATGAACGGTCGCAGTCTGCCTTGTCAACGATG--TATGAGTATCTTTATTTTTAAGAAACCAAAGCATGTATCA 18 (173) pss ACGCGTCTTGTCCTTTTTATGCGGGGGGATAAAATAGTAAGGAACATGAAAAGATTGGCATTCATTTTTCAAAAGGTAA-----CAAATGTTGTATAATAATAGAATTTGAATGCTGCTTTTT 15 (174) pydhyo5 TGGTCATCTGTCCTGATTTTTCACTTTTTTGATTTAATTTCAGTATTGCATTTATACAGCACGGCTATTGCCAAATGTC---CCCATGGATTCTATAGTAGAAATTGTCAAGATTGGGGGATT 17 (168) rib P2 GCAAACGGCCGTTTCGGAGGCCATTTCGTCTCAGGCCATGTCGACGGAACTGCGGAAATCACACGAATTGAAGAGAAAA---GCAACGCAGTTTACTATGATTTAAAAATGGACCCGTCATTA 17 (127) rnpA GAAGGGAAAGAATATGTGGTCCAAGACGGAGATGTTATTCATTTCCGATTTAATGTATAGGATGCAGTTGTAAAGGGAC---AAGAGCTTTGGTATAATATAAAATTGTGAGTAATAGAATTA 17 (139) rodC TTCAATATCTAATTAAAGTACTTCTTATTGAAATAAGAAGTACTTTTTGATGCTTACATTGATTTTTGTGACTAAAG--TATCCGGGTAGATATAAATTTCAATGATCATATATTCTAGAT 18 (175) rplN AAAATCGGTGACATCGTTAAGATCATGGAAACTCGTCCATTGTCTGCAACTAAGCGTTTCCGTCTAGTTGAAGTTGTCG----AAGAAGCTGTTATTATCTAATAAAGTTCGGAATTCTTTTT 16 (176) rpoB AACTGTTCGATGAAGTTTCCGTCGTTCAAAAAAAGAAAGGCTATTATATCATAAAAGCAAAAAAAGTTTGACTCGGTAT---TTTAACTATGTTAATATTGTAAAATGCCAATGTATATATTT 17 (177) rpsF GAAAGCATAAAGCGTGCTTGAATTTTCAATTATTTCCCTTCTGATTCGGAACAAAATGATGAAAAAAATGAAACGCTTT-AATCTTTTTTTGATAGAATAGAAGCAAGATAGTACATGTTCAT 19 (139) rtporf1 CCAAACCGAGTTTTTCAATTCAATGGACATAAAATAAAGAAAATGTAAATCGGACAATCGTTTCACATTGAAGATACGG---TGAAAATCGACTATAATAGAACTAAGTGAACTGTGAACCAA 17 (132) scRNA GTGCGTTTTTCAGAGAACTAAGAAAAAAGAAGAAAGCCGCCAGGAAAAACTTGTCTGAATAGTACGGTTGCAATTTTTA---GGGGAAACAGATATACTTAAGTGTGCATCGTAATAGATGCA 17 (178) secA TGAATAATGAAGAGAAGCCTTCCGTGATGTCCGCGGAAGGTTTTTGTTTTTCTTATTTGCAAATTCTTTGGAAATAACA----AAAGGTATGATATGATAATGAGAGGTATACATGGACTAGT 16 (179) senS GGAAAAGAGTGTATAAGGAAAAAGCGGGGATGCAATCTGATACAGTGTCAACACCCTCAAAAAATAGTTGACAGGTCGG--TATTGTATGAATTAACATGGTCAGTACAAATTTTTCAAATTT 18 (180) serS ACCGAGTGACGCAGCTGTTTGTTGAAATGGTTGAGGAATATAAGCAAAAGGCACTTGTATAAAACAGTTGAAAGCTGTG---GAAACTTATAGTACATTATAAGCACAAATAAAGATCGAAAA 17 (139) sin TTTTTTGAGAAAATACGATTATAATAAAGGTATATTGGAAAAAAATTCTGGTGATTTAATGGCAAATGACTTCCAGA-GACTAATGAAGCATACAATAAGTCATGGCCGGACTGGCTGAAA 19 (181) sipS GATTCATTTCTTTCAATATTTTCAGGCCTAGTTATGATCGACAAGAAAAAATAGGCATGATGTGGGTAGAAGATGAAG--ATTAACAGTTTGTAAAATCACTTCAATGGTCCTAATGGGATT 18 (182) slp ATAAAAAATAAAAAGCCATGCGGCTTTAAGCCGCATGCTTTTTTTTACTCTTCATCAACAGGACATTGACATTGTCC-GCAGCAAGTTCCATATAATGTTGTCACTTTCTCATCTTCAAAG 19 (168) spo0K AGAAGGATATTATGTTCATGGAAGAAAAACTAACGAAGTTTAAATATTTTAAATTGATAAAATAATATTGCAATAAATT---ATTTGTTTCATTATAATGAACTTGTTCACTCTATTGTTACA 17 (183) tag TGTAAAGATAATGTTAATCCTTTGTTGAAGATTTATGTTAAAATATAAGGTAGCTTGATTTTGCTTTTAGAAACTCTCG---GTTTTTAACTATATAAATAGAATCTTAAAGGAAGGAGGAGC 17 (184) tenAI CCGTTTAATTGTCACCGGATCTCGGGGGTACGTAACGGATCTTAAGAAAACATTGGAAGGATAAATCTTGACCAAATAA----GGATTCGTGTTAATATAGAGGTGCAGAACAATTCAATATG 16 (185) tetBSM ACTTGAGATAAATGCGAATAACGTTTTTCCTTGTTTCGCAATCTGGTCAAATTTTTATAAAAAAAGTAAAAGTTTAATCCTTAGTCTATATATAATAAGATCATATCAATCAAATGTAGG -- (100) thrZ TGCTTGTATGGCTGTTTCTGGCTGCCCATAACGGGACTGCCGCGTCAGAAAAAATGTAAATCACTGATTGCGCTTTGTG---GGAATATATAGTAAGATATAAAAAATTATTGAAACAACAGG 17 (186) thyB AAGATGAAGAAAAAGAACAGGATGAAAAGCCTGTCGTCAGCTGACTATAAAAAAATCATTTCTGGGTTCAAAAATGAT--TTTTTATTGTGTTACACTACTAGAAGACTACTTTTAAAGGAT 18 (187) trnJ TATGCCGGTGTAGCTCAATTGGTAGAGCAACTGACTTGTAATCAGTAGGTTGGGGGTTCAAGTCCTCTTGCCGGCACCA---CTTTTATATGATATAATACTCAAGTCTCTTGTAGAAGAGCC 17 (86) trpS AACGTCAGAGTGATTCCATTTTAATGGAATAATCAGGGTGGTACCACGGTTCATTCGTCCCTTTTTTACAGGGGAAGAATGAGCCTTTTTTATTATGTTTTAAGAAATGAGGTTGATGTT 20 (188) tycA TTGGATTTACGTAAAAAGGTTGTAAAAAAACTTGTTGAATTTTTTGCAAAATATCCCTATTTTTTAATCGATCTCCAAT----TTTTCTCTGCTATAATGAGTTTCAGCGTCAGTAACCTAGT 16 (189) valS CATATGTAAACTTGGGCAATAGGTGCCTGCCCATCTGTATAGAAAGCGGTGTTTTTGGAAAAGATGATTGACGAATCAA--AAACACTTTTACTATAATAAAGAACATAAATAATGTATACAA 18 (190) xpaC CGCCATTATATTCATAGACCTGAAAAGGTCTTTTTTTGTACTCTTAATAATAAAAAGAAGATGAAACTTGTTTAAGGAT---TGAACGTAGTAGATAATAATAATAAAACTGAGTATAGACAC 17 (139)

The left column is the gene designation for each promoter sequence. Promoters are defined by the first downstream gene if an operon is present. In the case of multiple start sites, promoters are designated P1, P2 etc., as in the original citation. The spacer length (SL) and the method used to determine the start site (SS) are indicated to the right of each sequence. The abbreviations used are: PE, primer extension transcript mapping; S1, S1-nuclease transcript mapping; RN, RNA analysis by either high resolution ron-off transcription or, in some cases, by RNA sequencing. The last column contains the reference to the promoter sequence, or when available, to the determination of start site.